Genetic predictors of the response to the treatment of hepatitis C virus infection

Authors

  • Pavlina Dzekova-Vidimliski University Hospital of Nephrology, Skopje, R. Macedonia
  • Igor G. Nikolov University Hospital of Nephrology, Skopje, R. Macedonia
  • Nadica Matevska-Geshkovska Faculty of Farmacy, University “Ss Cyril and Methodius”, Skopje, R. Macedonia
  • Yana Boyanova Clinic of Gastroenterology, St Ivan Rilski University Hospital, Sofia, R.Bulgaria
  • Nina Nikolova Clinic of Gastroenterology, St Ivan Rilski University Hospital, Sofia, R.Bulgaria
  • Grigore Romanciuc Université de Medicine "Nicolae Testemitanu" Chisinau, Moldova
  • Dan Dumitrascu University of Medicine and Pharmacy Iuliu Hatieganu, Cluj-Napoca, Romania
  • Viktorija Caloska-Ivanova University Hospital of Gastroenterohepatology, Skopje, R. Macedonia
  • Nenad Joksimovic University Hospital of Gastroenterohepatology, Skopje, R. Macedonia
  • Krasimir Antonov Clinic of Gastroenterology, St Ivan Rilski University Hospital, Sofia, R.Bulgaria
  • Lyudmila Mateva Clinic of Gastroenterology, St Ivan Rilski University Hospital, Sofia, R.Bulgaria
  • Lionel Rostaing Department of Nephrology, Dialysis and Organ Transplantation, CHU Rangueil, Toulouse, France
  • Aleksandar Dimovski Faculty of Farmacy, University “Ss Cyril and Methodius”, Skopje, R. Macedonia
  • Aleksandar Sikole University Hospital of Nephrology, Skopje, R. Macedonia

DOI:

https://doi.org/10.17305/bjbms.2015.632

Keywords:

single nucleotide polymorphisms, interferon-lambda protein, hepatitis C chronic, treatment

Abstract

The genome-wide association studies have identified a strong association between interleukin 28B (IL28B) gene polymorphisms and the response to treatment in patients with hepatitis C virus (HCV) infection. The aim of the study was to evaluate the association between three most widely studied IL28B gene polymorphisms and the response to antiviral treatment of chronic hepatitis C. We performed the genotyping of the three IL28B gene polymorphisms: rs12979860, rs8099917, and rs12980275 in 72 Caucasian patients with chronic hepatitis C, previously treated with the combination therapy of pegylated interferon alpha (PEGIFN α) and ribavirin (RBV). The patients included in the study had finished the treatment regimen at least 6 months before enrolling in the study. We used the sustained viral response (SVR) for the evaluation of the effectiveness of the antiviral treatment, and it was tested with an assay with a sensitivity of 20 IU/mL. An SVR was achieved in 59.7% (43/72) of the treated patients. The three IL28B gene polymorphisms (CC genotype of rs12979860, TT genotype of rs8099917, and AA genotype of rs12980275) were associated with the SVR (p = 0.029, p = 0.016, and p = 0.028, respectively) in the study patients with chronic hepatitis C treated with the combination therapy of PEGIFN α and RBV. The association of IL28B gene polymorphisms with the treatment response points to the possibility of personalized medicine for the treatment of HCV infection.

Downloads

Download data is not yet available.

References

Wands JR. Prevention of hepatocellular carcinoma. N Engl J Med 2004;351(15):1567-70. http://dx.doi.org/10.1056/NEJMe048237.

Jiménez-Sousa MA, Fernández-Rodríguez A, Guzmán-Fulgencio M, García-Álvarez M, Resino S. Meta-analysis: Implications of interleukin-28B polymorphisms in spontaneous and treatment-related clearance for patients with hepatitis C. BMC Med 2013;11:6. http://dx.doi.org/10.1186/1741-7015-11-6.

Hayes CN, Imamura M, Aikata H, Chayama K. Genetics of IL28B and HCV – Response to infection and treatment. Nat Rev Gastroenterol Hepatol 2012;9(7):406-17. http://dx.doi.org/10.1038/nrgastro.2012.101.

Glue P, Rouzier-Panis R, Raffanel C, Sabo R, Gupta SK, Salfi M, et al. A dose-ranging study of pegylated interferon alfa-2b and ribavirin in chronic hepatitis C. The hepatitis C intervention Therapy Group. Hepatology 2000;32(4):647-53. http://dx.doi.org/10.1053/jhep.2000.16661.

Kronenberger B, Zeuzem S. Current and future treatment options for HCV. Ann Hepatol 2009;8(2):103-12.

Muir AJ, Gong L, Johnson SG, Lee MT, Williams MS, Klein TE, et al. Clinical pharmacogenetics implementation consortium (CPIC) guidelines for IFNL3 (IL28B) genotype and PEG interferon-a-based regimens. Clin Pharmacol Ther 2014;95(2):141-6. http://dx.doi.org/10.1038/clpt.2013.203.

Chayama K, Hayes CN. Interleukin-28B polymorphisms and hepatitis C virus clearance. Genome Med 2013;5(1):6. http://dx.doi.org/10.1186/gm410.

Dhingra A, Kapoor S, Alqahtani SA. Recent advances in the treatment of hepatitis C. Discov Med 2014;18(99):203-8.

Jacobson IM, Dore GJ, Foster GR, Fried MW, Radu M, Rafalsky VV, et al. Simeprevir with pegylated interferon alfa 2a plus ribavirin in treatment-naive patients with chronic hepatitis C virus genotype 1 infection (QUEST-1): A phase 3, randomised, double-blind, placebo-controlled trial. Lancet 2014;384(9941):403-13. http://dx.doi.org/10.1016/S0140-6736(14)60494-3.

Pearlman BL, Traub N. Sustained virologic response to antiviral therapy for chronic hepatitis C virus infection: A cure and so much more. Clin Infect Dis 2011;52(7):889-900. http://dx.doi.org/10.1093/cid/cir076.

Fried MW, Shiffman ML, Reddy KR, Smith C, Marinos G, Gonçales FL Jr, et al. Peginterferon alfa-2a plus ribavirin for chronic hepatitis C virus infection. N Engl J Med 2002;347(13):975-82. http://dx.doi.org/10.1056/NEJMoa020047.

Booth DR, Ahlenstiel G, George J. Pharmacogenomics of hepatitis C infections: Personalizing therapy. Genome Med 2012;4(12):99. http://dx.doi.org/10.1186/gm400.

Yuen MF, Lai CL. Response to combined interferon and ribavirin is better in patients infected with hepatitis C virus genotype 6 than genotype 1 in Hong Kong. Intervirology 2006;49(1-2):96-8. http://dx.doi.org/10.1159/000087270.

Hadziyannis SJ, Sette H Jr, Morgan TR, Balan V, Diago M, Marcellin P, et al. Peginterferon-alpha2a and ribavirin combination therapy in chronic hepatitis C: A randomized study of treatment duration and ribavirin dose. Ann Intern Med 2004;140(5):346-55. http://dx.doi.org/10.7326/0003-4819-140-5-200403020-00010.

Ge D, Fellay J, Thompson AJ, Simon JS, Shianna KV, Urban TJ, et al. Genetic variation in IL28B predicts hepatitis C treatment-induced viral clearance. Nature 2009;461(7262):399-401. http://dx.doi.org/10.1038/nature08309.

Suppiah V, Moldovan M, Ahlenstiel G, Berg T, Weltman M, Abate ML, et al. IL28B is associated with response to chronic hepatitis C interferon-alpha and ribavirin therapy. Nat Genet 2009;41(10):1100-4. http://dx.doi.org/10.1038/ng.447.

Tanaka Y, Nishida N, Sugiyama M, Kurosaki M, Matsuura K, Sakamoto N, et al. Genome-wide association of IL28B with response to pegylated interferon-alpha and ribavirin therapy for chronic hepatitis C. Nat Genet 2009;41(10):1105-9. http://dx.doi.org/10.1038/ng.449.

Rauch A, Kutalik Z, Descombes P, Cai T, Di Iulio J, Mueller T, et al. Genetic variation in IL28B is associated with chronic hepatitis C and treatment failure: A genome-wide association study. Gastroenterology 2010;138(4):1338-45, 1345.e1-7.

Marcello T, Grakoui A, Barba-Spaeth G, Machlin ES, Kotenko SV, MacDonald MR, et al. Interferons alpha and lambda inhibit hepatitis C virus replication with distinct signal transduction and gene regulation kinetics. Gastroenterology2006;131(6):1887-98. http://dx.doi.org/10.1053/j.gastro.2006.09.052.

Thomas E, Gonzalez VD, Li Q, Modi AA, Chen W, Noureddin M, et al. HCV infection induces a unique hepatic innate immune response associated with robust production of type III interferons. Gastroenterology 2012;142(4):978-88. http://dx.doi.org/10.1053/j.gastro.2011.12.055.

Lagging M, Askarieh G, Negro F, Bibert S, Söderholm J, Westin J, et al. Response prediction in chronic hepatitis C by assessment of IP-10 and IL28B-related single nucleotide polymorphisms. PLoS One 2011;6(2):e17232. http://dx.doi.org/10.1371/journal.pone.0017232.

Mangia A, Mottola L, Santoro R. Interleukin 28B polymorphisms as predictor of response in hepatitis C virus genotype 2 and 3 infected patients. World J Gastroenterol 2013;19(47):8924-8. http://dx.doi.org/10.3748/wjg.v19.i47.8924.

Tolmane I, Rozentale B, Keiss J, Ivancenko L, Subnikova N, Reinholde Z, et al. Interleukin 28B gene polymorphism and Association with chronic hepatitis C therapy results in Latvia. Hepat Res Treat 2012;2012(2):324090. http://dx.doi.org/10.1155/2012/324090.

Sticchi L, Di Biagio A, Rappazzo E, Setti M, De Rosa G, De Hoffer L, et al. Rs12979860 and rs8099917 single nucleotide polymorphisms of interleukin-28B gene: Simultaneous genotyping in Caucasian patients infected with hepatitis C virus. J Prev Med Hyg 2013;54(2):83-6.

Shaikh N, Waryah AM, Devrajani BR, Rajput MI, Hayat AS, Shaikh S. IL28B rs12980275 polymorphism shows association with response to treatment in Pakistani patients with chronic hepatitis C. J Med Virol 2015;87(5):814-20. http://dx.doi.org/10.1002/jmv.24100.

Domagalski K, Pawlowska M, Tretyn A, Halota W, Tyczyno M, Kozielewicz D, et al. Association of IL28B polymorphisms with the response to peginterferon plus ribavirin combined therapy in polish patients infected with HCV Genotype 1 and 4. Hepat Mon 2013;13(11):e13678. http://dx.doi.org/10.5812/hepatmon.13678.

Aziz H, Raza A, Ali K, Khattak JZ, Irfan J, Gill ML. Polymorphism of the IL28B gene (rs8099917, rs12979860) and virological response of Pakistani hepatitis C virus genotype 3 patients to pegylated interferon therapy. Int J Infect Dis 2015;30:91-7. http://dx.doi.org/10.1016/j.ijid.2014.09.021.

Hardy J, Singleton A. Genomewide association studies and human disease. N Engl J Med 2009;360(17):1759-68. http://dx.doi.org/10.1056/NEJMra0808700.

Thomas DL, Thio CL, Martin MP, Qi Y, Ge D, O'Huigin C, et al. Genetic variation in IL28B and spontaneous clearance of hepatitis C virus. Nature 2009;461(7265):798-801. http://dx.doi.org/10.1038/nature08463.

Genetic predictors of the response to the treatment of hepatitis C virus infection

Downloads

Additional Files

Published

2015-11-12

How to Cite

1.
Dzekova-Vidimliski P, Nikolov IG, Matevska-Geshkovska N, Boyanova Y, Nikolova N, Romanciuc G, Dumitrascu D, Caloska-Ivanova V, Joksimovic N, Antonov K, Mateva L, Rostaing L, Dimovski A, Sikole A. Genetic predictors of the response to the treatment of hepatitis C virus infection. Biomol Biomed [Internet]. 2015Nov.12 [cited 2023Sep.28];15(4):55-9. Available from: https://www.bjbms.org/ojs/index.php/bjbms/article/view/632

Issue

Vol. 15 No. 4 (2015)

Section

Translational and Clinical Research

INTRODUCTION

Hepatitis C virus (HCV) infects an estimated number of 200 million people worldwide and is associated with an increased risk of the development of liver cirrhosis and hepatocellular carcinoma [1,2]. HCV viruses are classified into six genotypes, from 1 to 6. The HCV genotype 1 is the most common genotype worldwide and one of the most difficult to treat [3]. Before 2011, the standard treatment for chronic hepatitis C included pegylated interferon alpha 2a or 2b (PEGIFN) in combination with ribavirin (RBV) [4,5]. In 2011, two first-generation HCV protease inhibitors (boceprevir and telaprevir), given in combination with PEGIFN and RBV, were approved for the treatment of HCV genotype 1 infections in many countries [6,7]. In 2014, a combination therapy of the second-generation protease inhibitor (simeprevir) or polymerase inhibitor (sofosbuvir) with PEGIFN/RBV was approved to improve the treatment response in patients infected with HCV genotype 1 [8,9]. The primary goal of the treatment is HCV eradication, which is synonymous with the sustained viral response (SVR). The SVR is defined as undetectable HCV RNA in serum, 24 weeks after the completion of the antiviral treatment [10].

The PEGIFN/RBV treatment is prolonged and expensive, complicated by side effects leading to treatment discontinuation, and only about one-half of the treated patients achieve the SVR [11]. The addition of the first-generation protease inhibitors to the PEGIFN/RBV therapy has led to higher SVR rates (70-80%) for patients naive to the HCV treatment while SVR rates were lower for patients who failed to respond to previous treatment with PEGIFN/RBV [12]. For all these reasons, the prediction of the response rate before starting the treatment of chronic hepatitis C is of great importance. The viral and host factors are involved in predicting the treatment response. The viral factor, HCV genotype, is used for making the decision for the treatment duration and the prediction of the response rate, although the predictive value of HCV genotype is only 55% [13]. The patients with HCV genotype 2 or 3 are treated for 24 weeks and have a relatively high rate of SVR (70-80%). Those infected with HCV genotype 1 or 4 have a much lower rate of SVR (40%) despite the need for 48 weeks of treatment [14]. The host genetic factors may also predict the outcome of the chronic hepatitis C treatment. Four genome-wide association studies (GWAS) had already associated treatment-induced clearance of HCV following PEGIFN/RBV therapy with the single nucleotide polymorphisms (SNPs) near the interleukin 28B (IL28B) gene on chromosome 19 [15-18]. The IL28B gene encodes Type III IFN: IFN lambda (IFNλ), which possess antiviral activities against HCV [19,20]. The GWAS showed that SNPs near the IL28B gene (CC for rs12979860, TT for rs8099917, and AA for rs12980275) were associated significantly with a successful treatment of chronic hepatitis C.

The aim of the study was to evaluate the association between three most widely studied IL28B gene polymorphisms and the response to the treatment of chronic hepatitis C.

MATERIALS AND METHODS

A group of 72 adult Caucasian patients with chronic hepatitis C, treated routinely with an antiviral therapy, was investigated in the study. The study was approved by the local Ethics Committee and written informed consent was obtained from each study participant. The patients included in the study had finished the treatment regimen at least 6 months before enrolling in the study. The patients were previously treated with a standard of care protocol with PEGIFN α in combination with RBV. A standard dose of e PEGIFN α was administered subcutaneously once a week (PEGIFN α-2a: 180 µg and PEGIFN α-2b: 1.5 µg/kg). RBV was administered daily with a dose of 1000 mg for patients with a body weight of less than 75 kg and 1200 mg for patients with a body weight over 75 kg when combined with PEGIFN α-2a. When combined with PEGIFN α-2b, the RBV dose was 800 mg for patients with a body weight of less than 65 kg, 1000 mg for patients with a body weight between 65-85 kg and 1200 mg for patients with a body weight higher than 85 kg. The treatment duration was 24 weeks for patients infected with HCV genotype 3, and 48 weeks for patients infected with HCV genotype 1. SVR was used for the assessment of the antiviral treatment effectiveness. SVR is defined as an absence of detectable HCV RNA in serum, 6 months after the completion of the antiviral treatment.

Peripheral blood samples in ethylenediamine tetraacetic as an anticoagulant were obtained from each patient enrolled in the study.

HCV qua.jpgication

HCV RNA was extracted from plasma using QIAamp Viral RNA kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Reverse transcriptase-polymerase chain reaction (RT-PCR) assay for HCV qua.jpgication was done with HCV Real-TM Quant (Sacace Biotechnologies, Como, Italy) on Stratagene MX3005P real-time PCR system (Agilent Technologies, Edinburgh, UK) according to the manufacturer’s instructions. The detection limit of the assay was 20 IU/mL.

IL28B polymorphisms genotyping

Peripheral blood mononuclear cells (PBMCs) were isolated with density-gradient centrifugation using Histopaque-1077 (Sigma-Aldrich, Munich, Germany) and homogenized in Tri Reagent Solution (Ambion, Life Technologies, Carlsbad, CA, USA). Genomic DNA was extracted from PBMCs homogenized in Tri Reagent Solution (Ambion, Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions and genotyped for three IL28B polymorphisms: rs8099917, rs12979860, and rs12980275. The rs8099917 polymorphism was genotyped using the TaqMan predesigned SNP genotyping assay (reference C_11710096_10, Applied Biosystems) according to the manufacturer’s recommended protocol in a total volume of 25 µL. The two later SNPs were genotyped using custom designed TaqMan assays with the following primes and probes: TCTACTGAACCAGGGAGCTC, GCGCGGAGTGCAATTCAAC, 6Fam-TGGTTCACGCC TTC, Vic-TGGTTCGCGCCTTC for rs12979860, and GTG CTGAGAGAAGTCAAATTCC, CCGCTACCCGGCAAA TATT, 6Fam-ACACGTCCGTTTCTA, Vic-AGACACGT CTGTTTCTA for rs12980275 [21]. For both assays, 20 ng of DNA was used in a total volume of 25 µL including 12, 5 µL TaqMan Universal PCR master Mix (×2), 1 µM of each primer and 200 nM of each probe. The PCR reaction conditions were as follows: Initial denaturing at 95°C for 10 minutes; 40 cycles of 15 seconds at 92°C and 1 minutes at 64°C to reduce miss priming. Thermal cycling was performed using a Stratagene MX3005P real-time PCR system (Agilent Technologies, Edinburgh, UK). Both positive and negative controls were included in each genotyping assay.

A statistical analysis of data was performed using the SPSS software version 17 (IBM Corporation). The parametric variables were presented as the mean and standard deviations. A logistic regression model was used to determine the genetic predictors of the SVR. Odds ratios (ORs) and 95% confidence intervals (95% CIs) were derived from the logistic regression model. A p < 0.05 was considered statistically significant.

RESULTS

The SVR was achieved in 59.7% (43/72) of the treated patients, confirmed by RT-PCR assay with a detection limit of 20 IU/mL. The HCV genotype 1 was present in most of the patients (95.8%, 69/72). The demographic data of the patients, distribution of HCV genotypes, and SVR rate are presented in Table 1.

TABLE 1: The demographic data, distribution of HCV genotypes, and SVR rate in patients

The distribution of the frequencies of rs12979860 genotypes in the study group was as follows: 20 (28%) patients with CC genotype, 41 (57%) patients with CT genotype, and 11 (15%) patients with TT genotype (Table 2). The distribution of the frequencies of rs8099917 genotypes was: 42 (58%) patients with TT genotype, 23 (32%) patients with TG genotype, and 7 (10%) patients with GG genotype (Table 2). The distribution of the frequencies of rs12980275 genotypes was: 23 (32%) patients with AA genotype, 39 (54%) patients with AG genotype, and 10 (14%) patients with GG genotype (Table 2).

TABLE 2: Distribution of the frequencies of the IL28B gene polymorphisms in the study participants

The logistic regression analysis showed that the CC genotype of rs12979860 was associated with the achievement of SVR as compared with non-CC genotypes (OR = 1.30, 95% CI 1.03-1.62, p = 0.029) (Table 3). The SVR was achieved in 80% of patients with the CC genotype of rs12979860 compared with 51.9% of patients with the non-CC genotypes. The SVR was achieved in significantly more patients with the TT genotype of rs8099917 than in patients with non-TT genotypes (OR = 1.33, 95% CI 1.05-1.66, p = 0.016) (Table 3). Furthermore, the AA genotype of rs12980275 was associated with the achievement of SVR as compared with non-AA genotypes (OR = 1.29, 95% CI 1.03-1.62, p = 0.028) (Table 3).

TABLE 3: Association between the SVR and IL28B gene polymorphisms

DISCUSSION

The GWAS [15-18] ide.jpgied that homozygosis for the C allele of rs12979860, homozygosis for the T allele of rs8099917, and homozygosis for the A allele of rs12980275 were favorable genotypes of the IL28B gene polymorphisms which predicted the SVR in patients with chronic hepatitis C treated with PEGIFN/RBV. The same favorable genotypes of the IL28B gene polymorphisms were associated with the SVR in the patients of this study. Most of the studies investigated the effect of the SNPs near the IL28B gene on SVR in patients with HCV genotype 1. Almost all of the treated patients in our study were infected with HCV genotype 1, except for two patients infected with dual infection (genotype 1 and 3) and only one patient infected with genotype 3. The studies of Rauch et al. [18] and Mangia et al. [22] confirmed similar effects of the IL28B gene polymorphisms on SVR in Caucasian patients infected with HCV genotypes 2, 3, and 4 as in the patients with HCV genotype 1.

The distribution of the frequencies of rs12979860 genotypes in our study group was: CC in 28%, CT in 57%, and TT in 15% of the participants. In Latvia, the majority of the people are Caucasians, and they reported a similar distribution of the frequencies of rs12979860: CC in 33%, CT in 53%, and TT in 14% of the study participants (Caucasians, n = 142) [23]. In northern Italy, the distribution of rs8099917 genotypes was: TT in 55%, TG in 40%, and GG in 5% of the study participants (Caucasians, n = 175) [24]. The distribution of the frequencies of rs8099917 genotypes in our study group was similar, TT in 58%, TG in 32%, and GG in 10% of the participants.

The SVR rate was 59.7% in our study group, and it was associated significantly with favorable genotypes of the IL28B gene polymorphisms. Consistent to our findings were the results of the studies of Shaikh et al. [25] and Domagalski et al. [26]. The study of Shaikh et al. included a cohort of 220 Caucasian (Pakistani) patients with chronic hepatitis C treated with PEGIFN/RBV [25]. The SVR rate was 45.5%, and there was a significant association between the SVR and IL28B gene polymorphisms. The CC genotype of rs12979860, TT genotype of rs8099917, and AA genotype of rs12980275 were associated with the successful treatment (p = 0.001, p = 0.032, and p = 0.0001, respectively). Domagalski et al. determined the predictability of IL28B gene polymorphisms on the treatment response in a cohort of 174 Caucasian (Polish) patients infected with HCV genotype 1 and 4 treated with PEGIFN/RBV [26]. The CC genotype of rs12979860, TT genotype of rs8099917, and AA genotype of rs12980275 were associated significantly with the successful treatment (p = 0.001, p = 0.016, and p = 0.002, respectively).

The IL28B gene encodes cytokine type III IFN, which serves as a natural barrier to a viral infection. The human body is capable of producing cytokines differently depending on the polymorphism of the cytokine production genes [27]. However, the dynamic interactions between genes or between genes and the existing environment affect cytokine production and thus the immune response [28]. About 20% of treated patients with a favorable CC genotype of rs12979860 did not achieve SVR [29]. Other factors, such as ethnicity and HCV genotype should be used together with the IL28B genotype as pretreatment predictors of response.

CONCLUSION

Genetic analysis of the host may predict the patients that are more likely to respond to the antiviral treatment, since IL28B gene polymorphisms can influence treatment response, suggesting the possibility of personalized medicine for the treatment of hepatitis C.

DECLARATION OF INTERESTS

The authors declare no conflict of interest.

Acknowledgements

ACKNOWLEDGMENTS

This study was supported by the Agence Universitaire de la Francophonie (AUF). Authors wish to thank Mihaela Codreanu from AUF, for her administrative support in the organization and realization of the regional multicenter collaboration.

REFERENCES

  1. (). Prevention of hepatocellular carcinoma. N Engl J Med. http://dx.doi.org/10.1056/NEJM.e048237
  2. , , , , (). Meta-analysis: Implications of interleukin-28B polymorphisms in spontaneous and treatment-related clearance for patients with hepatitis C. BMC Med. http://dx.doi.org/10.1186/1741-7015-11-6
  3. , , , (). Genetics of IL28B and HCV – response to infection and treatment. Nat Rev Gastroenterol Hepatol. http://dx.doi.org/10.1038/nrgastro.2012.101
  4. , , , , , (). Adose-ranging study of pegylated interferon alfa-2b and ribavirin in chronic hepatitis C. The hepatitis C intervention Therapy Group. Hepatology. http://dx.doi.org/10.1053/jhep.2000.16661
  5. , (). Current and future treatment options for HCV. Ann Hepatol.
  6. , , , , , (). Clinical pharmacogenetics implementation consortium (CPIC) guidelines for IFNL3 (IL28B) genotype and PEG interferon-a-based regimens. Clin Pharmacol Ther. http://dx.doi.org/10.1038/clpt.2013.203
  7. , (). Interleukin-28B polymorphisms and hepatitis C virus clearance. Genome Med. http://dx.doi.org/10.1186/gm410
  8. , , (). Recent advances in the treatment of hepatitis C. Discov Med.
  9. , , , , , (). Simeprevir with pegylated interferon alfa 2a plus ribavirin in treatment-naive patients with chronic hepatitis C virus genotype 1 infection (QUEST-1): A phase 3, randomised, double-blind, placebo-controlled trial. Lancet. http://dx.doi.org/10.1016/S0140-6736(14)60494-3
  10. , (). Sustained virologic response to antiviral therapy for chronic hepatitis C virus infection: A cure and so much more. Clin Infect Dis. http://dx.doi.org/10.1093/cid/cir076
  11. , , , , , (). Peginterferon alfa-2a plus ribavirin for chronic hepatitis C virus infection. N Engl J Med. http://dx.doi.org/10.1056/NEJMoa020047
  12. , , (). Pharmacogenomics of hepatitis C infections: Personalizing therapy. Genome Med. http://dx.doi.org/10.1186/gm400
  13. , (). Response to combined interferon and ribavirin is better in patients infected with hepatitis C virus genotype 6 than genotype 1 in Hong Kong. Intervirology. http://dx.doi.org/10.1159/000087270
  14. , , , , , (). Peginterferon-alpha2a and ribavirin combination therapy in chronic hepatitis C: A randomized study of treatment duration and ribavirin dose. Ann Intern Med. http://dx.doi.org/10.7326/0003-4819-140-5-200403020-00010
  15. , , , , , (). Genetic variation in IL28B predicts hepatitis C treatment-induced viral clearance. Nature. http://dx.doi.org/10.1038/nature08309
  16. , , , , , (). IL28B is associated with response to chronic hepatitis C interferon-alpha and ribavirin therapy. Nat Genet. http://dx.doi.org/10.1038/ng.447
  17. , , , , , (). Genome-wide association of IL28B with response to pegylated interferon-alpha and ribavirin therapy for chronic hepatitis C. Nat Genet. http://dx.doi.org/10.1038/ng.449
  18. , , , , , (). Genetic variation in IL28B is associated with chronic hepatitis C and treatment failure: A genome-wide association study. Gastroenterology. 1345.e1-7
  19. , , , , , (). Interferons alpha and lambda inhibit hepatitis C virus replication with distinct signal transduction and gene regulation kinetics. Gastroenterology. http://dx.doi.org/10.1053/j.gastro.2006.09.052
  20. , , , , , (). HCV infection induces a unique hepatic innate immune response associated with robust production of type III interferons. Gastroenterology. http://dx.doi.org/10.1053/j.gastro.2011.12.055
  21. , , , , , (). Response prediction in chronic hepatitis C by assessment of IP-10 and IL28B-related single nucleotide polymorphisms. PLoS One. http://dx.doi.org/10.1371/journal.pone.0017232
  22. , , (). Interleukin 28B polymorphisms as predictor of response in hepatitis C virus genotype 2 and 3 infected patients. World J Gastroenterol. http://dx.doi.org/10.3748/wjg.v19.i47.8924
  23. , , , , , (). Interleukin 28B gene polymorphism and Association with chronic hepatitis C therapy results in Latvia. Hepat Res Treat 2012. http://dx.doi.org/10.1155/2012/324090
  24. , , , , , (). Rs12979860 and rs8099917 single nucleotide polymorphisms of interleukin-28B gene: Simultaneous genotyping in Caucasian patients infected with hepatitis C virus. J Prev Med Hyg.
  25. , , , , , (). IL28B rs12980275 polymorphism shows association with response to treatment in Pakistani patients with chronic hepatitis C. J Med Virol. http://dx.doi.org/10.1002/jmv.24100
  26. , , , , , (). Association of IL28B polymorphisms with the response to peginterferon plus ribavirin combined therapy in polish patients infected with HCV Genotype 1 and 4. Hepat Mon. http://dx.doi.org/10.5812/hepatmon.13678
  27. , , , , , (). Polymorphism of the IL28B gene (rs8099917, rs12979860) and virological response of Pakistani hepatitis C virus genotype 3 patients to pegylated interferon therapy. Int J Infect Dis. http://dx.doi.org/10.1016/j.ijid.2014.09.021
  28. , (). Genomewide association studies and human disease. N Engl J Med. http://dx.doi.org/10.1056/NEJMra0808700
  29. , , , , , (). Genetic variation in IL28B and spontaneous clearance of hepatitis C virus. Nature. http://dx.doi.org/10.1038/naturne08463